Peanut Marker Database

AhTE0178 Information

Marker name AhTE0178
Marker category Transposable Element
Primer sequences Fw GGTCCAGTCCATAGTTTGAAGC
Rv TCCAGCTCACAGACAGAAACAT
EST/Genome sequences AhTE8i_HP0_H09
Lines 8
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 109.563
TF6 Linkage TA03
Position 112.056
Integrated consensus map Linkage B03
Position 9.622
Integrated consensus map Linkage A03
Position 151.562
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR 58
Detection
Multiplex
Gel image image4043.jpg,image4044.jpg,image8081.jpg
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea