Peanut Marker Database

AHS2979 Information

Marker name AHS2979
Marker category EST-SSR
Primer sequences Fw CCACTTGCATGAACCTCCTT
Rv AAGCTTTTCCGTTCAAAGCA
EST/Genome sequences AHCR19L22
Lines
PIC Value
Lines
Map BF6 Linkage BB03
Position 20.078
TF6 Linkage TA03
Position 51.585
Integrated consensus map Linkage B03
Position 57.644
Integrated consensus map Linkage A03
Position 90.031
SNP Position
Method
SSR Fragment size 195
Pattern* GGA(mis2)
Repeat count 7
Method PCR
Detection
Multiplex
Gel image AHS2976_3000.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea