Marker name | AHS2553 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | CCTCTCTGTCTTTCGATGCC | |
Rv | GCGGGCCTCTAGATCTTCTT | ||
EST/Genome sequences | AHCR04E15 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | TF6 | Linkage | TB05 |
Position | 61.036 | ||
TF6 | Linkage | TA05 | |
Position | 36.991 | ||
Integrated consensus map | Linkage | A05 | |
Position | 60.822 | ||
Integrated consensus map | Linkage | B05 | |
Position | 101.727 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 160 | |
Pattern* | AAC | ||
Repeat count | 9 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS2551_2575.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.