Marker name | AHS2541 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | AGAGAGAACCCTCAGCCACA | |
Rv | CAAGCAGGTGCTGGTACTGA | ||
EST/Genome sequences | AHCR04G22 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | BF6 | Linkage | BB08 |
Position | 24.776 | ||
BF6 | Linkage | BB01 | |
Position | 8.695 | ||
TF6 | Linkage | TA01 | |
Position | 43.567 | ||
Integrated consensus map | Linkage | A01 | |
Position | 77.125 | ||
Integrated consensus map | Linkage | B01 | |
Position | 43.466 | ||
Integrated consensus map | Linkage | B08 | |
Position | 81.188 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 229 | |
Pattern* | GGC | ||
Repeat count | 13 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS2526_2550.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.