Marker name | AHS2398 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | ATGAGCGTCCTGCTTCTGTC | |
Rv | ATTTAAGGGACTTCTGGGGC | ||
EST/Genome sequences | AHCL11A19 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA09 |
Position | 13.558 | ||
BF6 | Linkage | BB07 | |
Position | 40.034 | ||
Integrated consensus map | Linkage | B07 | |
Position | 94.53 | ||
Integrated consensus map | Linkage | A09 | |
Position | 80.011 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 289 | |
Pattern* | AAAC(mis2) | ||
Repeat count | 4 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS2376_2400.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.