Marker name | AHS2312 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | CTTACCCACCAATTCTTCGC | |
Rv | TTGCTTCAGCAAAGTCAACG | ||
EST/Genome sequences | AHCL17H22 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | SKF2 | Linkage | LG04.1 |
Position | 76.98 | ||
TF6 | Linkage | TB04 | |
Position | 50.496 | ||
TF6 | Linkage | TA04 | |
Position | 31.842 | ||
Integrated consensus map | Linkage | A04 | |
Position | 28.201 | ||
Integrated consensus map | Linkage | B04 | |
Position | 42.212 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 200 | |
Pattern* | GGT(mis1) | ||
Repeat count | 7 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS2301_2325.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.