Marker name | AHS2062 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | GCCCTTCTTAAATCACACGG | |
Rv | GGTCAAACTTTCCAAGGTGC | ||
EST/Genome sequences | AHCL07L22 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA07 |
Position | 12.225 | ||
BF6 | Linkage | BB07 | |
Position | 32.746 | ||
Integrated consensus map | Linkage | B07 | |
Position | 91.646 | ||
Integrated consensus map | Linkage | A07 | |
Position | 70.919 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 275 | |
Pattern* | AAAT(mis2) | ||
Repeat count | 5 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS2051_2075.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.