Peanut Marker Database

AHS1969 Information

Marker name AHS1969
Marker category EST-SSR
Primer sequences Fw GCTAAACGACGAACCAAAGC
Rv GCGGCTGAGTAGTGGAGTTT
EST/Genome sequences AHCL07B07
Lines
PIC Value
Lines
Map BF6 Linkage BB08
Position 18.829
TF6 Linkage TA08
Position 66.166
Integrated consensus map Linkage B08
Position 60.252
Integrated consensus map Linkage A08
Position 81.015
SNP Position
Method
SSR Fragment size 203
Pattern* AAG
Repeat count 8
Method PCR
Detection
Multiplex
Gel image AHS1951_1975.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea