Peanut Marker Database

AHS1960 Information

Marker name AHS1960
Marker category EST-SSR
Primer sequences Fw GGAGAGCTTCACTGCTTTGG
Rv CTTCTTGGCCTCCACATGAT
EST/Genome sequences AHCL03P23
Lines
PIC Value
Lines
Map TF6 Linkage TA05
Position 25.54
TF6 Linkage TA09
Position 39.198
Integrated consensus map Linkage A09
Position 74.625
Integrated consensus map Linkage A05
Position 48.216
SNP Position
Method
SSR Fragment size 107
Pattern* AAT
Repeat count 9
Method PCR
Detection
Multiplex
Gel image AHS1951_1975.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea