Marker name | AHS1545 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | GCCCTGTTGTTTCTGTCCAC | |
Rv | GGAACAATGAAGCAGGGAAA | ||
EST/Genome sequences | AHCG09N04 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | BF6 | Linkage | BB04 |
Position | 17.957 | ||
TF6 | Linkage | TA04 | |
Position | 57.765 | ||
Integrated consensus map | Linkage | A04 | |
Position | 51.608 | ||
Integrated consensus map | Linkage | B04 | |
Position | 60.161 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 173 | |
Pattern* | AAG(mis2) | ||
Repeat count | 5 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS1526_1550.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.