| Marker name | AHS1510 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | AAAAGCACTTCACCCCCTTT | |
| Rv | GAGCTGAACCTGCTTTCCAG | ||
| EST/Genome sequences | AHCG07E10 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | AF5 | Linkage | AA07 |
| Position | 7.978 | ||
| BF6 | Linkage | BB07 | |
| Position | 38.798 | ||
| TF6 | Linkage | TA07 | |
| Position | 31.854 | ||
| TF6 | Linkage | TB06 | |
| Position | 14.583 | ||
| Integrated consensus map | Linkage | B07 | |
| Position | 85.27 | ||
| Integrated consensus map | Linkage | A07 | |
| Position | 68.25 | ||
| Integrated consensus map | Linkage | B06 | |
| Position | 80.655 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 299 | |
| Pattern* | AAC(mis2) | ||
| Repeat count | 5 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image |
AHS1501_1525.ppt [download] |
||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.