Marker name | AHS1510 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | AAAAGCACTTCACCCCCTTT | |
Rv | GAGCTGAACCTGCTTTCCAG | ||
EST/Genome sequences | AHCG07E10 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA07 |
Position | 7.978 | ||
BF6 | Linkage | BB07 | |
Position | 38.798 | ||
TF6 | Linkage | TA07 | |
Position | 31.854 | ||
TF6 | Linkage | TB06 | |
Position | 14.583 | ||
Integrated consensus map | Linkage | B06 | |
Position | 80.655 | ||
Integrated consensus map | Linkage | B07 | |
Position | 85.27 | ||
Integrated consensus map | Linkage | A07 | |
Position | 68.25 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 299 | |
Pattern* | AAC(mis2) | ||
Repeat count | 5 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS1501_1525.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.