Peanut Marker Database

AHS1474 Information

Marker name AHS1474
Marker category EST-SSR
Primer sequences Fw GAGAGAGAGAGGCACCTCCA
Rv TAGATGGGTTCGCCAGAAGT
EST/Genome sequences AHCG05A19
Lines
PIC Value
Lines
Map AF5 Linkage AA06
Position 36.203
AF5 Linkage AA09
Position 13.848
Integrated consensus map Linkage A09
Position 80.531
Integrated consensus map Linkage A06
Position 64.313
SNP Position
Method
SSR Fragment size 300
Pattern* AAT(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image AHS1451_1475.ppt [download]
Enzyme
Related markers Marker name
Species
Comments
Koilkonda et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea