| Marker name | AHS1343 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | AGCTTCCTACGGCAATGCTA | |
| Rv | GGTTGAGTTGGCAAAAGAGC | ||
| EST/Genome sequences | AHCS13L16 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | AF5 | Linkage | AA10 |
| Position | 31.284 | ||
| Integrated consensus map | Linkage | A10 | |
| Position | 85.978 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 187 | |
| Pattern* | AAG(mis2) | ||
| Repeat count | 5 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image |
AHS1326_1350.ppt [download] |
||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.