Marker name | AHS1004 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TTCAAACTCCCCAACCAAAC | |
Rv | ACCCTGATTGTTGCCTTGAC | ||
EST/Genome sequences | AHCG07A02 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | BF6 | Linkage | BB10 |
Position | 26.252 | ||
TF6 | Linkage | TA02 | |
Position | 48.337 | ||
TF6 | Linkage | TA10 | |
Position | 6.493 | ||
Integrated consensus map | Linkage | B10 | |
Position | 66.896 | ||
Integrated consensus map | Linkage | A02 | |
Position | 39.686 | ||
Integrated consensus map | Linkage | A10 | |
Position | 96.667 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 294 | |
Pattern* | AT(mis2) | ||
Repeat count | 8 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS1001_1025.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.