Marker name | AHS0878 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | CAACAGCAGAAGAGCGAGTG | |
Rv | TGAGAGAAGCGGTAGGGTTG | ||
EST/Genome sequences | AHCG18O20 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA09 |
Position | 19.315 | ||
Integrated consensus map | Linkage | A09 | |
Position | 86.569 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 224 | |
Pattern* | AG(mis2) | ||
Repeat count | 9 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS0876_0900.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.