Marker name | AHS0312 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TATTCCCTCTCGTCCCCTCT | |
Rv | GCGAAAAGTGGTTGTGATGA | ||
EST/Genome sequences | AHCG03B08 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | BF6 | Linkage | BB03 |
Position | 21.35 | ||
TF6 | Linkage | TA03 | |
Position | 50.151 | ||
TF6 | Linkage | TB03 | |
Position | 73.133 | ||
Integrated consensus map | Linkage | B03 | |
Position | 58.439 | ||
Integrated consensus map | Linkage | A03 | |
Position | 88.172 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 243 | |
Pattern* | AC | ||
Repeat count | 15 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image |
AHS0301_0325.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.