| Marker name | AHS0312 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | TATTCCCTCTCGTCCCCTCT | |
| Rv | GCGAAAAGTGGTTGTGATGA | ||
| EST/Genome sequences | AHCG03B08 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | BF6 | Linkage | BB03 |
| Position | 21.35 | ||
| TF6 | Linkage | TA03 | |
| Position | 50.151 | ||
| TF6 | Linkage | TB03 | |
| Position | 73.133 | ||
| Integrated consensus map | Linkage | A03 | |
| Position | 88.172 | ||
| Integrated consensus map | Linkage | B03 | |
| Position | 58.439 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 243 | |
| Pattern* | AC | ||
| Repeat count | 15 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image |
AHS0301_0325.ppt [download] |
||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.