Peanut Marker Database

AHGS5730 Information

Marker name AHGS5730
Marker category Genome-SSR
Primer sequences Fw TGATACAAAAATGGAAATTATGGG
Rv TGTAATGAGGCCAAGGCAAG
EST/Genome sequences SAAC0709D18
Lines
PIC Value
Lines
SNP Position
Method
SSR Fragment size 163
Pattern* AC
Repeat count 10
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea