Peanut Marker Database

AHGS5719 Information

Marker name AHGS5719
Marker category Genome-SSR
Primer sequences Fw AGTAATCCTTTCCTGGGCGT
Rv AATACGGCACTCGAAGTTGG
EST/Genome sequences SAAC0707G01
Lines
PIC Value
Lines
SNP Position
Method
SSR Fragment size 237
Pattern* AAAT
Repeat count 5
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea