Marker name | AHGS3712 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | TTTGTGCGTGTCTGTGATGA | |
Rv | ACGCCCACTGCTTCTACTGT | ||
EST/Genome sequences | SACT11E04 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | BF6 | Linkage | BB09 |
Position | 17.358 | ||
TF6 | Linkage | TA06 | |
Position | 48.357 | ||
TF6 | Linkage | TA10 | |
Position | 10.276 | ||
TF6 | Linkage | TB09 | |
Position | 15.752 | ||
Integrated consensus map | Linkage | A10 | |
Position | 91.619 | ||
Integrated consensus map | Linkage | B09 | |
Position | 70.362 | ||
Integrated consensus map | Linkage | A06 | |
Position | 48.945 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 188 | |
Pattern* | GGGA(mis2) | ||
Repeat count | 5 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.