Peanut Marker Database

AHGS2535 Information

Marker name AHGS2535
Marker category Genome-SSR
Primer sequences Fw CGCTAGTGACGACAAAGCAG
Rv TCATCTTCTCCGATCCTTCG
EST/Genome sequences KICT05G09
Lines
PIC Value
Lines
Map SKF2 Linkage LG01.1
Position 34.427
NYF2 Linkage LG01.1
Position 14.509
AF5 Linkage AA01
Position 17.504
TF6 Linkage TA01
Position 45.382
TF6 Linkage TA09
Position 37.808
Integrated consensus map Linkage A09
Position 78.649
Integrated consensus map Linkage A01
Position 76.538
SNP Position
Method
SSR Fragment size 129
Pattern* AG
Repeat count 12
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea