Peanut Marker Database

AHGS2390 Information

Marker name AHGS2390
Marker category Genome-SSR
Primer sequences Fw CGGCGTTTTCAATTTGACTT
Rv TCTGGTTTGTTCCACCCTTC
EST/Genome sequences SACT08L10
Lines
PIC Value
Lines
Map AF5 Linkage AA04
Position 49.672
TF6 Linkage TB04
Position 35.916
TF6 Linkage TA04
Position 71.11
Integrated consensus map Linkage A04
Position 62.428
Integrated consensus map Linkage B04
Position 95.147
SNP Position
Method
SSR Fragment size 116
Pattern* AG
Repeat count 13
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea