Peanut Marker Database

AHGS2322 Information

Marker name AHGS2322
Marker category Genome-SSR
Primer sequences Fw ACCAAGTTTTCTGCCAATGC
Rv CCCATGAAACGCTGATTACC
EST/Genome sequences KICT07F16
Lines
PIC Value
Lines
Map AF5 Linkage AA04
Position 8.704
TF6 Linkage TB04
Position 32.294
TF6 Linkage TA04
Position 8.472
Integrated consensus map Linkage A04
Position 11.347
Integrated consensus map Linkage B04
Position 8.694
SNP Position
Method
SSR Fragment size 289
Pattern* AG
Repeat count 14
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea