Marker name | AHGS2155 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GCTTGCTCTTCTGCTTCGAT | |
Rv | TTCAGCAGAGAATGTGACAAAAA | ||
EST/Genome sequences | KICT12E11 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | SKF2 | Linkage | LG04.2 |
Position | 71.584 | ||
AF5 | Linkage | AA04 | |
Position | 42.992 | ||
BF6 | Linkage | BB04 | |
Position | 23.378 | ||
TF6 | Linkage | TB04 | |
Position | 13.186 | ||
TF6 | Linkage | TA04 | |
Position | 56.856 | ||
Integrated consensus map | Linkage | A04 | |
Position | 55.204 | ||
Integrated consensus map | Linkage | B04 | |
Position | 66.63 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 299 | |
Pattern* | AG | ||
Repeat count | 16 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.