Marker name | AHGS2100 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | CAATAACGTATGCCATTTTCACA | |
Rv | CGTGTGAGCCAAGAAGACAG | ||
EST/Genome sequences | SACT10K22 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | SKF2 | Linkage | LG04.1 |
Position | 46.519 | ||
AF5 | Linkage | AA10 | |
Position | 25.025 | ||
BF6 | Linkage | BB04 | |
Position | 23.688 | ||
TF6 | Linkage | TB04 | |
Position | 13.148 | ||
Integrated consensus map | Linkage | A10 | |
Position | 90.952 | ||
Integrated consensus map | Linkage | B04 | |
Position | 70.806 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 209 | |
Pattern* | AG | ||
Repeat count | 16 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.