| Marker name | AHGS1918 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | AGACCCAGAAAACGAAAGCA | |
| Rv | TCTTTTCTGCTCCCCTCTCA | ||
| EST/Genome sequences | SACT13K14 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | SKF2 | Linkage | LG01.2 |
| Position | 27.351 | ||
| NYF2 | Linkage | LG01.1 | |
| Position | 14.436 | ||
| BF6 | Linkage | BB01 | |
| Position | 11.93 | ||
| TF6 | Linkage | TA01 | |
| Position | 63.483 | ||
| TF6 | Linkage | TB01 | |
| Position | 37.888 | ||
| Integrated consensus map | Linkage | B01 | |
| Position | 42.547 | ||
| Integrated consensus map | Linkage | A01 | |
| Position | 79.541 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 294 | |
| Pattern* | AAG | ||
| Repeat count | 12 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.