Marker name | AHGS1790 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GGACGATAGCAACATCAGCA | |
Rv | GGGCTAAATTCAAACGCAAA | ||
EST/Genome sequences | SACT05J06 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | SKF2 | Linkage | LG09.1 |
Position | 63.492 | ||
AF5 | Linkage | AA03 | |
Position | 25.413 | ||
BF6 | Linkage | BB01 | |
Position | 2.61 | ||
BF6 | Linkage | BB09 | |
Position | 4.932 | ||
TF6 | Linkage | TB09 | |
Position | 19.118 | ||
Integrated consensus map | Linkage | B01 | |
Position | 44.222 | ||
Integrated consensus map | Linkage | B09 | |
Position | 61.905 | ||
Integrated consensus map | Linkage | A03 | |
Position | 85.219 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 217 | |
Pattern* | AG | ||
Repeat count | 19 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.