Marker name | AHGS1778 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | CGGCTGCGGTATTCTGATAG | |
Rv | GGATTTTGGTTATGAAATGCTTG | ||
EST/Genome sequences | SAAC06H20 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA04 |
Position | 40.582 | ||
BF6 | Linkage | BB04 | |
Position | 26.423 | ||
BF6 | Linkage | BB07 | |
Position | 36.067 | ||
BF6 | Linkage | BB10 | |
Position | 20.85 | ||
Integrated consensus map | Linkage | B04 | |
Position | 67.118 | ||
Integrated consensus map | Linkage | B07 | |
Position | 89.802 | ||
Integrated consensus map | Linkage | B10 | |
Position | 61.614 | ||
Integrated consensus map | Linkage | A04 | |
Position | 50.278 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 236 | |
Pattern* | AC | ||
Repeat count | 19 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.