Peanut Marker Database

AHGS1756 Information

Marker name AHGS1756
Marker category Genome-SSR
Primer sequences Fw GAAAGACAAAACAAGGGCGA
Rv AAAGGGAAAAAGATGTCGGG
EST/Genome sequences KICT08M23
Lines
PIC Value
Lines
Map SKF2 Linkage LG06.2
Position 41.972
AF5 Linkage AA06
Position 8.393
TF6 Linkage TA06
Position 35.493
TF6 Linkage TB06
Position 15.162
Integrated consensus map Linkage B06
Position 71.632
Integrated consensus map Linkage A06
Position 35.766
SNP Position
Method
SSR Fragment size 290
Pattern* AG
Repeat count 20
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea