Peanut Marker Database

AHGS1492 Information

Marker name AHGS1492
Marker category Genome-SSR
Primer sequences Fw GCATAGCAAAATCGGAGGAA
Rv AAGGTCCATCAGCAACCAAC
EST/Genome sequences SACT05A07
Lines
PIC Value
Lines
Map BF6 Linkage BB03
Position 11.782
TF6 Linkage TA03
Position 27.466
Integrated consensus map Linkage B03
Position 46.948
Integrated consensus map Linkage A03
Position 65.979
SNP Position
Method
SSR Fragment size 294
Pattern* AG
Repeat count 23
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea