Peanut Marker Database

AHGS1356 Information

Marker name AHGS1356
Marker category Genome-SSR
Primer sequences Fw TCACTTTACCAACCTCCTCAAAA
Rv TCATTGGATCTTCGTGGGAT
EST/Genome sequences SACT10K16
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.1
Position 39.867
TF6 Linkage TA03
Position 33.398
Integrated consensus map Linkage B09
Position 86.32
Integrated consensus map Linkage A03
Position 72.693
SNP Position
Method
SSR Fragment size 287
Pattern* AG
Repeat count 26
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea