Peanut Marker Database

AHGS1298 Information

Marker name AHGS1298
Marker category Genome-SSR
Primer sequences Fw TTCACTCGCTCTTTCCCAGT
Rv TGCATCATCTTTTTCCCTCC
EST/Genome sequences KICT05E16
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 81.676
BF6 Linkage BB10
Position 20.262
TF6 Linkage TB03
Position 57.51
TF6 Linkage TA07
Position 43.762
Integrated consensus map Linkage A07
Position 82.109
Integrated consensus map Linkage B03
Position 42.177
Integrated consensus map Linkage B10
Position 61.11
SNP Position
Method
SSR Fragment size 282
Pattern* AG
Repeat count 28
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea