Peanut Marker Database

AHGS1100 Information

Marker name AHGS1100
Marker category Genome-SSR
Primer sequences Fw GAATTTGTTGGTGGATCCCT
Rv TTCTCTCCCTCGAAGCACTC
EST/Genome sequences SACT14D10
Lines
PIC Value
Lines
Map BF6 Linkage BB07
Position 34.729
TF6 Linkage TB07
Position 24.341
TF6 Linkage TA03
Position 49.912
Integrated consensus map Linkage A03
Position 88.423
Integrated consensus map Linkage B07
Position 91.991
SNP Position
Method
SSR Fragment size 210
Pattern* AG
Repeat count 39
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea