Peanut Marker Database

Genome-SSR Marker List

Total Entries: 6706

Show rows.

Marker Name Marker Type Primer(Fw) Primer(Rv)
AHGS5600 Genome-SSR TGACGGTGAGAACTGAGCTG TTAGGGATGGCAGCAGTACC
AHGS5601 Genome-SSR CCCATTCGAACCAAATCAAT GTGAATAATCTCACTAAAAGCCACT
AHGS5602 Genome-SSR GTTCCCACTCCCCTACAGGT GCAGAAGCACATGCAAAATC
AHGS5603 Genome-SSR TCGATTAGACACCTATTGCTTCA ACCGTATAACCGCTCCAAAA
AHGS5604 Genome-SSR TTGTACATCCGAGGTGGTGA TGGGTAGCTAGGCAGGATTTT
AHGS5605 Genome-SSR TTCCAACAAATTCCCCACAC AAACCATTTATGTCCATTGCTTG
AHGS5606 Genome-SSR AGCCAACTTTGAGCCTACGA TCCCATGTTTTCCCACACTT
AHGS5607 Genome-SSR GGGAAGCACTGGTGTAGAGC TCTGCAAGGGAGACGGATAC
AHGS5608 Genome-SSR GGCTCTGTGTGGTAGGGTGT AAGTCCAAAATGCATGCTCA
AHGS5609 Genome-SSR CATCATGCTAGCACCCACTC GCTGAGGAGAGCGCTAAAGA
AHGS5610 Genome-SSR GCGGAGTGGTTACTGGGTAG TGCAAAGTCAAGACTGACCG
AHGS5611 Genome-SSR GAGTCCTTTGACTTGCGAGG CGCTTCCCTGGGATACTTAG
AHGS5612 Genome-SSR ACCGTATAACCGCTCCAAAA ACCAACCAATCATCCGACTC
AHGS5613 Genome-SSR AGAGGGATTAGGAGTTGCGA TCCCCTTTTTCACAAATGTCT
AHGS5614 Genome-SSR ACTTGGCGTTCTCTCTGCAT CTCAACCCACGAAGTCAAGG
AHGS5615 Genome-SSR TTGGCTGTGGGTTATGTTCA GATGGACATGACGACCAAAA
AHGS5616 Genome-SSR TGGGACTAAGGCAAAGGTGA CCACATTAGCACTTGCAACC
AHGS5617 Genome-SSR TCCCAAGCTACGAATGGTTC ATACCAGGACGCCGTAGTTG
AHGS5618 Genome-SSR GACACCAAGCCTCCAAAAGA ACTCAGCCCACGAAGTCAAG
AHGS5619 Genome-SSR AAAGGACAACAAGACGCCAC AACGCTTTGCGCTTTGTAAT
AHGS5620 Genome-SSR TCGGCATTGTGAAGAGTGAG CATCAGGTTTATCCGCTGGT
AHGS5621 Genome-SSR GCGCAACCTTCTCTCTCTCT TTTGTTGTAGTTGCTCCATTGAA
AHGS5622 Genome-SSR GGTTTCGAGAAGGGAGGAAC AAAACAAGCCGGTAAACCCT
AHGS5623 Genome-SSR TGTGCGCGAGAAAGATAAGA CCATTCATTCCAATTCACCC
AHGS5624 Genome-SSR ATTTACAAGCGGACGGAATG GTGAGGCTGAAGCATGTGAA
AHGS5625 Genome-SSR ACGAATAGCCACCACTCACC TAGGTAGTGACAAGCACGGC
AHGS5626 Genome-SSR CGCTTTGTTTTGATGACTCG CAACGGTAGCAGCTTGTTCA
AHGS5627 Genome-SSR CAAAAACAAACGCCAAACAA ATGGCTTCGATTTGGATCAG
AHGS5628 Genome-SSR CGTGTTTCTGTCACCCATCA TCTTCTTTGTGCGCCTCTCT
AHGS5629 Genome-SSR TGCAATAGCAGAAGCCACAA TCCACTGGAAAAGGGAGAAA
AHGS5630 Genome-SSR CTTGGAATTAGAATCGGCCA ACTCTCTCACACACACCCCC
AHGS5631 Genome-SSR TAAAACTTTAGGCACCGCCA TGCAATTCATTACCCCTTCA
AHGS5632 Genome-SSR GAGAGTCTTGGTTCTTGGCG TGCATAAAGGTGCTGCTGAA
AHGS5633 Genome-SSR ATGTTGAGGCACTTGGAAGG TAACAGAGCACAATGGCGTC
AHGS5634 Genome-SSR AGAGCGCAACAGAGCCTAAG ACGGCGATGACTTTTTCTGT
AHGS5635 Genome-SSR TCCTCTCTGCCGTGTTCTCT GACGAGGGAAATTGCAATACA
AHGS5636 Genome-SSR TGCCGAATAATGAGGGTCTC GGGTGAAGAGTGCAAAGAGC
AHGS5637 Genome-SSR ACAACACATGGAAGGGTGAA CTGAAAGTGCATTTCGCTGA
AHGS5638 Genome-SSR CAGAAATCCGAAGCATTGGT GGATGAGATTACTGCGGCAT
AHGS5639 Genome-SSR GAATTGGGTGGCTGAGAACA TGATGCAAGTCATCAGGAGG
AHGS5640 Genome-SSR AACGGAAAAGAGCACTCCAA TCTGCCACAGTAGTCATCGC
AHGS5641 Genome-SSR AAACCGCCACTATTATCCCA CCATGTTCTCATCAACCCTCT
AHGS5642 Genome-SSR GGTGTTACATTTCTCCCATGC TAGCTCAAAAATGCGACACG
AHGS5643 Genome-SSR TCAGCCAAGGCGTATTATCC GCCTGTTCTTCTTCAGTGGC
AHGS5644 Genome-SSR TTGGGTTGCTTTTAGATGAGC ATACCATTTGCGCAAGCAAT
AHGS5645 Genome-SSR ACCCAACCCAAGTTCCCTAC GCTTTTGGTTCTGCCCTACA
AHGS5646 Genome-SSR CCCTTGCTGGAGAGAGAAAG CCATCGGGAACCCTATTTTT
AHGS5647 Genome-SSR CCTGCTAAGGACAAAGCCAC ACTGGGAAATGGCAATGTGT
AHGS5648 Genome-SSR TGGTCTGAATGACAAGGTCG ACACCTCGCAGGGTGAATAC
AHGS5649 Genome-SSR TTCCCACTCACACACACACA AGGCGCGTATGAAATGAAAG

Total Entries: 6706

Go to page.
Total pages: 135

MarkerDB | Arachis hypogaea