Peanut Marker Database

Genome-SSR Marker List

Total Entries: 6706

Show rows.

Marker Name Marker Type Primer(Fw) Primer(Rv)
AHGS5550 Genome-SSR GAATGCTTCATGCGTGTTTG TGTTGCTGAAATGAAGGCAG
AHGS5551 Genome-SSR TTTGGATGTGATGTGTGCCT TTATATACGTTGGCGTCGCA
AHGS5552 Genome-SSR AGGGGGAATGCCTGATAAAC GAAAAGGGGTGGTGTGTGAT
AHGS5553 Genome-SSR TGGCAAGCAAGTGATGAGTC GTCGTCTTCCTCCTGCTGAG
AHGS5554 Genome-SSR CAAATTACGCACACACACCC CGACCTGAGCAATCTCCATT
AHGS5555 Genome-SSR TAGCAAGGTGTGGAAAAGGG TTCCGTGGGAAGTAACCTTG
AHGS5556 Genome-SSR TTGCACCTCAAACTGCAAAC AGAGCCTCTTCACACACTTCAA
AHGS5557 Genome-SSR TTTCTCTCCCACACCATGAA CGCCGGAGCTAATAACTTCT
AHGS5558 Genome-SSR TGAACAGGTCAGGGTCTCG CAACATTCAGATATCCAGCCTTT
AHGS5559 Genome-SSR GGTCTTGGTGACTCGTGGTT CCGTTCTCTCTTTCCCCTTT
AHGS5560 Genome-SSR CATATGCCCAGGAAGAGGAA CAAATTGTGCAGCCAAGAGA
AHGS5561 Genome-SSR TTTCTTGGCATTTCCCTACG AGTTCATGCTTGTTTTTGCCT
AHGS5562 Genome-SSR CTCCCTCGCCTTTAACTTTG TTTAAACCGCAATACCCCTG
AHGS5563 Genome-SSR CAATCACATCACTTTCTGAAACC TCACTTTGCATGGAGTTGTTG
AHGS5564 Genome-SSR CCAAACACTTGGCAACACTG ATGGACATGCAAGAAGGCTC
AHGS5565 Genome-SSR GTGTGTGCGTGTGTGTGTGT CTCGGGTATTACAACGACTCTT
AHGS5566 Genome-SSR TCTTCTGCGGAGGTAATGACT AAAGCTAGGGAATATGCAGAGA
AHGS5567 Genome-SSR TTACGTTGTGCTGACCTTCG CCGCAATACCTCTCCAAAAA
AHGS5568 Genome-SSR TTCAAGGCTTCTAGTTAAACTTCC AGGTGGAGGGGCTATGACTT
AHGS5569 Genome-SSR CCAAGGATCATGTTGAACCA CCTGAACTTTTTAGATGGTCATTG
AHGS5570 Genome-SSR TGGCTGAATAGGTATTTTTCTTG GGAAGTGAGCTCGGACAAAG
AHGS5571 Genome-SSR TCCTCTCTTCTCCGGCACTA TCTGTGCGAAGTTTGTGGAG
AHGS5572 Genome-SSR CTATGCCCCCTGTGGTCTAA CAGATCATTTTTGGATGGCA
AHGS5573 Genome-SSR GCTCAGGATATCGCGAAAAG CACAATGCTTCTCGCTTCTG
AHGS5574 Genome-SSR CTTCGGAAGAAGATGGTGAA AACCAAACCAGCCACAACTC
AHGS5575 Genome-SSR GAGGAGCCTTTGAAGGAAAGA TATGTTGGGCATTTTGGGTT
AHGS5576 Genome-SSR TTTCCCACAAATTCTCCCAC GAATTGTATCTTTGATTAGCTTGGG
AHGS5577 Genome-SSR TGTGTGGTCACAACTCCGTT GAGGTGGCGGAGTATTACGA
AHGS5578 Genome-SSR CATCCTCCTTTGCGTCTCTC TACACACCCGCCACTCATAA
AHGS5579 Genome-SSR AGCTTCGATTCTGAGGCTTG AATCCGTGGTGAGACCATGT
AHGS5580 Genome-SSR TTCTTGTGAATGTAAAGTATGATGAGA TTAGCCTGCGAAGTCAAGG
AHGS5581 Genome-SSR CTTAGCGTTGGGTCAGGGTA ACGCCCAGAGTAAACCACAC
AHGS5582 Genome-SSR TTCCCATTCGCTATGCATCT GGGAGGAAACACAGAGAAACA
AHGS5583 Genome-SSR CCTATCCGTCAAGAGAGGCA GGCTATGGCATCGAGAGAAG
AHGS5584 Genome-SSR CTTGCTGATTTGACGTCTGC CAAGCCCGTTAGCAACAAAT
AHGS5585 Genome-SSR CTATGGTGGTGGAATGGGAC CCAAGTCAGGTTTCACCGTT
AHGS5586 Genome-SSR TCAATTTTGAAGCATTTGAGACA AGGAGGAGTTAAAGGGCCAG
AHGS5587 Genome-SSR ATCAGCAAGCCCAATACCAC TGGGATGATCTCCCTCTCAC
AHGS5588 Genome-SSR CAGAGATTTGTTAGGGGGCA TCAACAGGAATAGCTGCACG
AHGS5589 Genome-SSR GACAGCGATGAGTCTGTGGA AAAACCCGCTAACTTCCGTT
AHGS5590 Genome-SSR AATCCGACGGTAATTGTTGG CCAGAGTGAGCGCTGGTC
AHGS5591 Genome-SSR CTCCGATGCTTATCCCAAAA CCCTGAATCAAAACCATCAAA
AHGS5592 Genome-SSR GTGATGGCCACCTTGACTGT ACGCAAAAGACATTATCGGC
AHGS5593 Genome-SSR CCAACTGAGACGGAGAGAGG AGGGAAGGAAGGAGAGAACG
AHGS5594 Genome-SSR ATGACGTTGTCATTGCCAGA TATTCGACGACCTCTTTGCC
AHGS5595 Genome-SSR TTCTTTGAAATATCATTCGGCA GGGAAGACTGGAGTTTACAGAG
AHGS5596 Genome-SSR TCGTTAGGACACACTAAATCTCCA GGAGGAACTGTCAGAGGTGG
AHGS5597 Genome-SSR CGTTTAGGCAACAACGAACA TTGATCTGTGACGGCAATGT
AHGS5598 Genome-SSR CGAACTGCAAACCTTCTTCC GCGATTAAAGGAGCAACGAC
AHGS5599 Genome-SSR ACCCAATTCATCAACGCTTC CCTCTCTCTCTCTCTCTCTCTCTCTC

Total Entries: 6706

Go to page.
Total pages: 135

MarkerDB | Arachis hypogaea