Peanut Marker Database

Genome-SSR Marker List

Total Entries: 6706

Show rows.

Marker Name Marker Type Primer(Fw) Primer(Rv)
AHGS5499 Genome-SSR GGCTTCAACACCAGCTCTTC CCACCGTCGCTATCAAGAAT
AHGS5500 Genome-SSR CGGTGGTGGTGTGGACTTTA CAGAAACGGACCCAACTCAT
AHGS5501 Genome-SSR TTTGGCCTGGAACATTTGAT TCATCACCACCGCATTAAAA
AHGS5502 Genome-SSR TCTGAGACAAATGCCTGTGG TGATCATCTGACGTCACCGT
AHGS5503 Genome-SSR TTCTTTTGAACACTCTCTCCGTC TCCGATGAGGACCCATAGAC
AHGS5504 Genome-SSR GGGTGGAGAAGAAATCAGCA TCTCTCGCTCTTTGTGGTCA
AHGS5505 Genome-SSR GGAACCAGAAGAGCAACGAG GGAATCTACAACCTTCGCCA
AHGS5506 Genome-SSR CCAAATTCCAAGGCTTTAACA CCTTCACCACCATTTTTGCT
AHGS5507 Genome-SSR ATTGAAACTCCCGGAATTGA GGAACTTTCTGAACAACCAAACA
AHGS5508 Genome-SSR AAAGTATGAAGAGCCAATGCAA ACAGCTTGATCTTCAGCGG
AHGS5509 Genome-SSR TTCTCTCCCCTTTACCCACC AGGTTGTTTCATCTCGGTGC
AHGS5510 Genome-SSR AGTTTTGATTGTTGGGGCAA AAATTTCGAATGTGGCTGAGA
AHGS5511 Genome-SSR CGCACAAACTATTGCTTGGA TTTCCAGTCATAGTGCCGAA
AHGS5512 Genome-SSR GAATGCCCACATTCTTAGCC AAGAGAGGGCGTGCTTTGTA
AHGS5513 Genome-SSR GGCAGTGACACCAGTAAGCA GCTGATTGTGAAGGCCTAGC
AHGS5514 Genome-SSR GGCAGAGTGACGTCATGAAA TCCACTTTCCATTCCTTTGC
AHGS5515 Genome-SSR TGAGCCTCGATGAAATACCC CTCTGCATTTCGCTTCCAAT
AHGS5516 Genome-SSR ACAGAGGCTCCTGGGTCAC CACCATCGCTTGAGGAGAAC
AHGS5517 Genome-SSR TTTAGCAAATCAGTAGTAATACATCCA AGTGTGAAGACCCAGGATGC
AHGS5518 Genome-SSR TGTGATCACCCTTGAAGTTTTG CCCGGTATGGATCTCTACGA
AHGS5519 Genome-SSR CTAACCCATGACCCATGACC CCCTTACCCCCATTCTTCTT
AHGS5520 Genome-SSR ATGGTACGCCCATTGAGAAG ACCAGTGGTAGCGGCATTAC
AHGS5521 Genome-SSR TGTGTGTGTTTGTGTGTGTGTG TGTTATGCTTCTGGCTGTGC
AHGS5522 Genome-SSR CGCCCACTCAAAAGTGCTA CTTCCTCTCTTGCGTTTTGG
AHGS5523 Genome-SSR AAAGCGAAGGTTAATCAAAGG TTCAAATACGGGTCGAGAGG
AHGS5524 Genome-SSR CATGCTGAGAACCTCCGATT AAGAACACACACACAAAACTAACGA
AHGS5525 Genome-SSR TGTAGTGGAGCTTGCGTTTG TCATCGTCATCCAATCCAGA
AHGS5526 Genome-SSR CTCCAATTTACATATACACCAACCT TGCATCATAGTGACAGTGGCT
AHGS5527 Genome-SSR TTCGGTGGTGAATGAAGAAA CCAATCTAATGAAAGCGTTTTGT
AHGS5528 Genome-SSR AGAAACAAAAGCGTGAAGGG ATTTGCGTATTTTTCGCTCG
AHGS5529 Genome-SSR GGATGGAGTATGGACAGCGT GCGAGATGAAAATGGGAAAA
AHGS5530 Genome-SSR ATTTGGTTGGAGCAAAATGC TGCTCTCTCAGTCGTCGTTG
AHGS5531 Genome-SSR TCTGCTGGTTTCAGTTGCAG ACCTATGAAGCCAAGGCCG
AHGS5532 Genome-SSR AGTGAGCACTGCACCTTGTG GCTCCCTCCAGCACTCTCTA
AHGS5533 Genome-SSR GGCAGCAGATCTTCCATTTC TTCCTTCCTTCAACTGCCAC
AHGS5534 Genome-SSR GCAAACATCATGGGGTCTCT TGGGTAGCTAGGCGTGATTT
AHGS5535 Genome-SSR CTAACCCTAAGCCACCCACA CATGGAGCTATTACCATCGGA
AHGS5536 Genome-SSR TGGTGAAAGAGGGAAACCAC GTGGTGGCAGAGATAGGGAA
AHGS5537 Genome-SSR CTTGCAAGATCAGTTGGCAG GATGGGTCCCACCTAAACCT
AHGS5538 Genome-SSR CCGGTAACTCGCACTCTCTC GGAAAGAAGCAAGGTTTTTGAA
AHGS5539 Genome-SSR ACCGAAACTATCCCGTTCCT ATGAGTGGCGATTGGTGAAT
AHGS5540 Genome-SSR TATTCTCGCTGCCACCTTTT TCCTTCTGCAGCTCCTTCTC
AHGS5541 Genome-SSR GACAAAGAGAGAGGGGGACC GCTTCCAATAGGAACGGACA
AHGS5542 Genome-SSR GGGTTCTCCAATCAAACCCT TTTGACGAAGGAAAATTCGG
AHGS5543 Genome-SSR ACACGGTTGTGAAGAGGAGG CCTTATAACTCCCACGGCCT
AHGS5544 Genome-SSR TCGGTTTCTCTCTCGCTCTC TTCGTGAAGTGTGAAGGACG
AHGS5545 Genome-SSR TCTCAAAATGGTGATTGGCA GTTTGCAGGCAACCAATGAT
AHGS5546 Genome-SSR TTTTCTGCTGCGGAAGCTAT CCTCACCCCCTGTATGTGAC
AHGS5548 Genome-SSR CCTTGTGTCGTAGCACCAAA TTTTGCAAGGGATAACGGTC
AHGS5549 Genome-SSR GATTTTCGGGTTCACCAAGA TGTATCGGTAATTAGGGACTACTAATG

Total Entries: 6706

Go to page.
Total pages: 135

MarkerDB | Arachis hypogaea