Marker name | EcES0315 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | AAAAGCGAAAATCCCCACTT | |
Rv | GTCGGATTTCAAGACGGGTA | ||
EST/Genome sequences | OJI17a01ngrl0026_d05_f | ||
Lines | |||
PIC | Value | 0.403 | |
Lines | 6 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 185 | |
Pattern* | GGAC | ||
Repeat count | 5 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image |
EcES0257_0320.ppt [download] |
||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.