Marker name | RSS1361 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TGCTTCTCGACGATGTCAAC | |
Rv | TAATCCCACCCTCTTTGTGC | ||
EST/Genome sequences | RSCL09H08 | ||
Map | GHRI | Linkage | LG3 |
Position | 8.5 | ||
SSR | Fragment size | 223 | |
Pattern* | GGA(mis2) | ||
Repeat count | 6 | ||
Method | PCR | 60 | |
Detection | PAGE | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.