| Marker name | RSS0662 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | CGAAAACTCCCATAGGTCCA | |
| Rv | TGACAAGTTCGCTCCTGATG | ||
| EST/Genome sequences | RSCS10P17 | ||
| Map | GHRI | Linkage | LG2 |
| Position | 10.9 | ||
| SSR | Fragment size | 161 | |
| Pattern* | GGAT(mis2) | ||
| Repeat count | 4 | ||
| Method | PCR | 60 | |
| Detection | PAGE | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.