Tomato Marker Database

original sequence
>SL_EcoRI0094B05_T7_357165 SL_EcoRI0094B05_T7_357165 Chromat_file:SL_EcoRI_094_B05-T7 SGN_GSS_ID:373991 (vector and quality trimmed)
TCATTAATTCGTTTTAGCTCCAAGTTTCTTAATTTTTCACCAACTTTATTCTACAAATAA
AATACGCAATTTAGCACTATTCATTCTTTTTATGGTCAAAATGGACATGTAGAAATAATA
AATGTGAGCAAATAATAATAAAAATGTGTATTTTTGCCTCACATGAATACACCACACTTA
AAACTTTTGTTCGTCCCCGATCAAACAATAAAGCTCATCTAAAAAATATAGTAATAGCAA
TGTCATCACTCTAACTAATACAATCAATCAGGCCATGTGTCAATTTCAAAATATCAGGTA
GATTTTTCAATCATTATGCAAGACATCCAAATGAACAACAAACCTCTAACTTCCTAACCT
CAAGGAAGGACTTTGAACTCATCACATTTAAGTTTGCTCACCTACTATCACCAAAAAAAG
TTAATAAAATCACCTATCTATCATGAAACAAGTGCCCTCACAAGAATAAATAGTCCACAC
ACTAAATTCAAAACACTCAATACAAATTAAAGACTTCATATCAAGAACAACTCCCACACT
CACAAATAAAATTCACATGTATGAACAAAAAGCTATATGTTTGCTCATTTTGTACATCTC
AACTAATTAAGCATGCTTTAATAGAATCAAATAGGACTTTGACGGGTTGTAACATACGCT
TGGGAAAGGTTAGGAAAATGATGTATTAGTGACTTCCAATTCCTTAAGCATTTT


MarkerDB | Solanum lycopersicum