Tomato Marker Database

TGS8221 Information

Marker name TGS8221
Marker category Genome-SSR
Primer sequences Fw TTGCCGATTTCTTCAGTGTG
Rv GGGGTTGGAGATCAACACAA
EST/Genome sequences SL_EcoRI0031H20_T7_306409
SSR Fragment size 136
Pattern* AAAG(mis2)
Repeat count 4
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum