| Marker name | TGS2858 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | CATGGTGTCGATAGGTGTGG | |
| Rv | GATTGACCGGAGAAGGATCA | ||
| EST/Genome sequences | SL_EcoRI0064I04_T7_337719 | ||
| Map | AMF2 | Linkage | ch11 |
| Position | 64.763 | ||
| SSR | Fragment size | 297 | |
| Pattern* | AAG(mis1) | ||
| Repeat count | 6 | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.