Marker name | TGS2649 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | AGGGAACTCTTTCATGGGCT | |
Rv | GAGGACCGGGAGAAAAAGAG | ||
EST/Genome sequences | SL_MboI0092P02_SP6_167995 | ||
Map | Expen2000 | Linkage | ch02 |
Position | 38.813 | ||
SSR | Fragment size | 170 | |
Pattern* | AAG(mis1) | ||
Repeat count | 6 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.