| Marker name | TGS2439 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GTTTCAGCACATGTTTGAGCA | |
| Rv | TGACTCAGGTGAGGAAGATGG | ||
| EST/Genome sequences | LE_HBa0228H04_T7_387661 | ||
| Map | AMF2 | Linkage | ch05 |
| Position | 49.349 | ||
| SSR | Fragment size | 239 | |
| Pattern* | AC(mis1) | ||
| Repeat count | 10 | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.