Marker name | TGS2326 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GACGGGGCTTAGATGAAACCT | |
Rv | TGACCACCCCTCAACCTTTA | ||
EST/Genome sequences | LE_HBa0196P03_T7_258825 | ||
Map | Expen2000 | Linkage | ch01 |
Position | 38.249 | ||
SSR | Fragment size | 235 | |
Pattern* | AAAT(mis1) | ||
Repeat count | 5 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.