Marker name | TGS2097 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | TTGTGAGAGCAATGTGCTAATCT | |
Rv | GAGTGTATCTATGGGTCAACTTTTT | ||
EST/Genome sequences | SL_EcoRI0071D13_SP6_342300 | ||
Map | Expen2000 | Linkage | ch06 |
Position | 100.816 | ||
SSR | Fragment size | 204 | |
Pattern* | AAT(mis1) | ||
Repeat count | 7 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.