| Marker name | TGS2021 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GCCCACGTAAATGTCAATACACC | |
| Rv | TGATGATATGCCCGAGTCAA | ||
| EST/Genome sequences | SL_EcoRI0022M08_SP6_229856 | ||
| Map | Expen2000 | Linkage | ch01 |
| Position | 35.062 | ||
| SSR | Fragment size | 265 | |
| Pattern* | AAT(mis1) | ||
| Repeat count | 7 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.