Marker name | TGS2002 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GACTGCAGCAGCCACTTCTTC | |
Rv | CCCACGATGATGTTACGTTG | ||
EST/Genome sequences | SL_MboI0124F18_SP6_193799 | ||
Map | Expen2000 | Linkage | ch08 |
Position | 81.496 | ||
SSR | Fragment size | 244 | |
Pattern* | AAG(mis1) | ||
Repeat count | 7 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.