Tomato Marker Database

TGS1648 Information

Marker name TGS1648
Marker category Genome-SSR
Primer sequences Fw GCAACGCACAATTCAACCATC
Rv TTTGGTACTACGTTTCCGCC
EST/Genome sequences LE_HBa0186K22_SP6_66186
SSR Fragment size 157
Pattern* GGT(mis1)
Repeat count 8
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum