| Marker name | TGS1644 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | CATTCGATAGAGGTGGCCTG | |
| Rv | GGACCAGACCAAGTTGAGGA | ||
| EST/Genome sequences | LE_HBa0062F12_SP6_54406 | ||
| Map | AMF2 | Linkage | ch02 |
| Position | 23.019 | ||
| SSR | Fragment size | 135 | |
| Pattern* | AG(mis1) | ||
| Repeat count | 12 | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.