Marker name | TGS1603 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | CACCTCAGGCATCCAAACTT | |
Rv | GCGGAGCTACAACCAATGAT | ||
EST/Genome sequences | SL_MboI0124H06_SP6_193871 | ||
Map | AMF2 | Linkage | ch02 |
Position | 26.78 | ||
SSR | Fragment size | 183 | |
Pattern* | AT(mis1) | ||
Repeat count | 13 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.